Erlang

Welcome to the 'Erlang' tag page at Technorati. This page features content from the farthest reaches of the Blogosphere that authors have "tagged" with 'Erlang'.

Latest blogosphere posts tagged “Erlang”

• Luke Galea on Ruby and Erlang

  
  Software Development Videos — Authority: 139
  In this interview taped at FutureRuby, Luke Galea talks about his experience with building sites using Ruby and Merb as well as integrating them using Erlang in the messaging layer. http://www.infoq.com/interviews/galea-ruby
  4 days ago

• Language exploration odyssey – Concurrency

  
  Living in the Tech Avalanche Generation — Authority: 115
  First time in a long while that a book purchase has been made by myself over the counter yesterday! I was compelled on a whim, a sudden urge took grip; and so it was that ‘ Programming Erlang ’ somehow made it’s way into my hands. I sat down and started to read. Immediately I bought into the authors style and ...
  4 days ago

• Interview with Michal Slaski and Rusty Klophaus

  
  Software Development Videos — Authority: 139
  Senior Erlang Consultant Michal Slaski and Creator of the Nitrogen Framework Rusty Klophaus were interviewed by Craig Smith of O’Reilly GMT.
  5 days ago

• Links for 18-Dec

  
  Distributed Memory — Authority: 459
  MSFT SCVMM updater for VM images version 2.1 released. Mixed-language assembly builds in Visual Studio . .net 4 highlights . Joe Armstrong approves of WebSockets . Immutable wrapper pattern . F#: Making F# type inference friendly to C# . Generic monads . FoldR on lazy infinite sequences . ...
  1 week ago

• Playing with Erlang (3): concurrency

  
  YOKOFAKUN — Authority: 109
  In this post Ill show how to write a multithreaded erlang program where each child process will calculate if a given number is a Prime Number (not rocket science, a brute force algorithm will be used).First this erlang module is called prime:-module(prime).The method named test with no argument is public ...
  1 week ago

• QCon London 2010 - 8th/9th March 2009

  
  O'ReillyGMT - Tech News from 4 timezones either side of the Greenwich Meridian — Authority: 106
  QCon London 2010 Tutorials: March 8-9, 2010 / Conference: March 10-12, 2010 QCon is always a fantastic event. Once again, its being held at The Queen Elizabeth II Conference Centre. There are over...
  1 week ago

• Playing with Erlang (II)

  
  YOKOFAKUN — Authority: 109
  transcripting a DNA to a RNA sequence with an anonymous functionlists:map(fun($T)->$U;(OTHER)->OTHER end,"AATAGCTGATCGACAATGTTAGCTAGGC").>"AAUAGCUGAUCGACAAUGUUAGCUAGGC"Testing if a symbol is an acid nucleic> ACIDNUCLEICS="ATGCatgc"."ATGCatgc"> lists:member($A,ACIDNUCLEICS).true> ...
  3 weeks ago

• Flash, Erlang and Realtime Collaborative Interfaces

  
  Mrinal Wadhwa — Authority: 103
  I’ve been learning Erlang for the past few weeks and loving the simplicity and beauty of the language. As part of a discussion at SAP TechEd , last week, I ended up creating a simple, rather rudimentary prototype of a realtime messaging server that enables collaborative user interfaces where multiple users can ...
  4 weeks ago

• Playing with Erlang (I)

  
  YOKOFAKUN — Authority: 109
  Im currently reading Joe Armstrongs "Programming Erlang". Here are a couple of notes about ERLANG.Starting and stopping the Erlang shell:~> erlErlang R13B01 (erts-5.7.2) [source] [smp:2:2] [rq:2] [async-threads:0] [hipe] [kernel-poll:false]Eshell V5.7.2 (abort with ^G)1> halt().:~>Simple ...
  4 weeks ago

• UKUUG - 2 New Tutorials Announced - Zenoss & Erlang

  
  O'ReillyGMT - Tech News from 4 timezones either side of the Greenwich Meridian — Authority: 106
  The UKUUG have announced two new Tutorials in conjunction with OReilly. On January 27th 2010 in London, we have Zenoss Introduction Workshop, led by Zenoss Master Jane Curry: Zenoss provides...
  4 weeks ago

Comments about Erlang